Role of the Agency for Health Research
Describe the role of the Agency for Health Research and Quality and the Centers for Disease Control and Prevention on directing the US Protective Services Task Force and the Community Task Force panel members.
Describe the role of the Agency for Health Research and Quality and the Centers for Disease Control and Prevention on directing the US Protective Services Task Force and the Community Task Force panel members.
Why is it important for nurses to learn about computer hardware? Compare and contrast computer hardware vs computer software
2. Do you think the use of cloud computing applies to healthcare?
3. How do you think mobile technology change the delivery of healthcare in the next 5 years?
Read the case scenario below. Risk for developing breast cancer. Visit www.cancer.gov to become familiar with the U.S. government’s primary agency for cancer research and after reviewing the recourses please answer the questions bellow. Make sure to include references from the website.
JF is a 26-year-old woman in the clinic today for her annual physical examination. As you take her medical history, it becomes apparent that she is quite concerned about her risk of developing breast cancer. Her mother and a maternal aunt both developed breast cancer in their late 40s. JF has heard that genetic testing can be done to see whether she carries “breast cancer genes.”
2. If genetic testing reveals that JF does carry the BRCA1 gene, what does this mean for her risk of developing breast cancer?
3. What proportion of breast cancer cases can be attributed to inherited forms?
4. What other cancer would JF be at risk for given the presence of the BRCA1 gene? How significant is that risk?
5. What other risk factors should be investigated to evaluate JF’s risk for breast cancer?
If you wanted to isolate a copy of the gene that Codes for a Protein found in the brain, could that gene be located in cheek cells? Explain your reasoning.
Complete the Overview Human Immunodeficiency Virus Case (HIV) lesson. ML is a 26-year-old homosexual man admitted to the hospital for progressive respiratory distress, fever, weakness, and chronic diarrhea. He tested HIV positive about 3 years ago, but his infection has remained asymptomatic until 2 months prior to admission. Pneumocystis jiroveci (carinii) pneumonia was suspected and confirmed by culture. Laboratory analysis demonstrates a low CD4+ count of 185 cells/ml. HAART treatment with the antiretrovirals azidothymidine (AZT, efavirenz (Sustiva), and ritonavir (Norvir) was started 2 months ago.
Deoxyribonucleic Acid restriction enzymes can be used to do all of the following except; to insert a gene in a plasmid,
-cut repetitive DNA for identification of a person
-make recombinant DNA
-to copy DNA
9. a mom dog has black fur BB, the father dog has white fur bb.
Bb is gray fur.
if the mom and dog have puppies, what is the ratio of black to gray to white fur?
Electrons from ___ will be used in the thylakoids for photosynthesis. electron transport chain
-water
-chloroplast
-pigments
6. plant crops can be genetically engineered to ___
-be resistant to pesticides
-be resistant to herbicides
-to be sensitive to herbicides
-be sensitive to pestidies
3. What is the correct order of aerobic respiration? electron transport, acetyl co A synthesis, glycolysis, citric acid cycle
-citric acid cycle, electron transport, glycoysis, acetyl co A production
-glycolysis, acetyl COA synthesis, citric acid cycle, electron transport
-acetyl co A production, glycoyslsis, electron transport, glycolysis
4. humans and bacteria make ____ as the result of fermentation.
-pyruvate
-ethanol
-oxygen
-lactic acid/lactate
1. if you were testing the effects of Potential of Hydrogen on flower production with the use of control and experimental groups, what is correct?
-change the pH and amount of times it is watered
-change the pH and amount of light
-change the pH and the soil
-you only change the pH
2. What molecule will sit in a membrane near unsaturated fatty acids?
-amino acid
-nucleotide
-cholesterol
-hormone
Deoxyribonucleic Acid Replication, Transcription, and Translation Activity BIOL 1020, 1023, 1024 Grading: 10 points total, 1 point per question To answer the following questions, download the document to your computer, then open and type (or write) your answers in any color except black or red. Include the questions with your answers in order to get full credit. Save to your computer, preferably as a pdf, and upload to the appropriate D2L assignment folder.
1. If a strand of DNA has the sequence shown below and serves as the template for the synthesis of a new strand of DNA, what would the sequence of the new strand be? ATCCGATC
2. What would be the sequence for a strand of mRNA transcribed from the template DNA strand shown below? ATCCGATC
3. What would the sequence be for a strand of mRNA transcribed from a DNA segment with the following sequence? TAGGCTAG
4. Which of the following DNA sequences contain(s) a mutation? a) TCAA b) CAGC C) AATT d) GATA AGTT GTCG TTAA CTCT
5. Given the following sequence of a portion of a DNA strand, determine the sequence of a complementary strand of mRNA: TACCCGTATACGATATGGTCAAG
6. Given the following sequence for a strand of mRNA, what would the resulting amino acid sequence be? AUG AAA CGG CAA CCA UUG AUC GAU
7. Point mutations are sources of error in DNA replication. Shown below are five mRNA sequences, including one sequence and four different point mutations.
Circle the codon where a mutation has occurred. Then use the genetic code table to note the effect the mutation will have on protein synthesis (e.g., different protein, no protein, neutral effect, etc.
Writemynursingpaper.com provides custom papers such as Essays, Term papers, Research papers, Theses, and Dissertations to its global clientele. These papers are only deemed as reference materials meant for providing assistance to our customers.

Email:
support@writemynursingpaper.com
phone: +1 (617) 871 9964
