Deoxyribonucleic Acid Replication Translation

Deoxyribonucleic Acid Replication, Transcription, and Translation Activity BIOL 1020, 1023, 1024 Grading: 10 points total, 1 point per question To answer the following questions, download the document to your computer, then open and type (or write) your answers in any color except black or red. Include the questions with your answers in order to get full credit. Save to your computer, preferably as a pdf, and upload to the appropriate D2L assignment folder.

1. If a strand of DNA has the sequence shown below and serves as the template for the synthesis of a new strand of DNA, what would the sequence of the new strand be? ATCCGATC

2. What would be the sequence for a strand of mRNA transcribed from the template DNA strand shown below? ATCCGATC

3. What would the sequence be for a strand of mRNA transcribed from a DNA segment with the following sequence? TAGGCTAG

4. Which of the following DNA sequences contain(s) a mutation? a) TCAA b) CAGC C) AATT d) GATA AGTT GTCG TTAA CTCT

5. Given the following sequence of a portion of a DNA strand, determine the sequence of a complementary strand of mRNA: TACCCGTATACGATATGGTCAAG

6. Given the following sequence for a strand of mRNA, what would the resulting amino acid sequence be? AUG AAA CGG CAA CCA UUG AUC GAU

7. Point mutations are sources of error in DNA replication. Shown below are five mRNA sequences, including one  sequence and four different point mutations.

Circle the codon where a mutation has occurred. Then use the genetic code table to note the effect the mutation will have on protein synthesis (e.g., different protein, no protein, neutral effect, etc.

Looking for a similar assignment? Get help from our qualified experts!

Our specialized Assignment Writers can help you with your custom paper today. 100% written from scratch

Order a Similar Paper Order a Different Paper
0 replies

Leave a Reply

Want to join the discussion?
Feel free to contribute!

Leave a Reply

Your email address will not be published.