The nucleotide sequence

A portion of the nucleotide sequence from the DNA coding strand of the chicken ovalbumin gene is shown. ATGGGCTCCATCGGTGCAGCAAGCATGGAA… 1040 bp … TTCTTTGGC AGATGTGTTTCCCCU (a) Write the partial amino acid sequence of the encoded protein. (b) Write the 20-residue primer sequences for PCR to amplify the above DNA. (c) Write a 20-residue primer to introduce a point mutation at the third amino acid to proline.