Early warning system tied to the Electronic Health Record

Discuss how a computerized early warning system tied to the Electronic Health Record can impact patient care. Consider whether it is more effective than bedside assessments analyzed by the individual RN.

In your initial post, respond to the following questions:

  • What is an early warning system and why is it important to patient care?
  • What protocols have influenced the development of an early warning system?
  • How widely adopted are early warning systems?
  • How do patient outcomes compare in a setting where an early warning system is used to a setting where an early warning system is not used?
  • How would you advocate for an early warning system in a setting that did not have one?

 

Explain what is Dominant epistasis

Explain what is Dominant epistasis I and what is Dominant epistasis II. What is the difference between them both?

Doctor of nursing practice and a Doctor of Philosophy in nursing

Discuss the difference between a doctor of nursing practice and a Doctor of Philosophy in nursing. Discuss why someone would choose to pursue if they decide to continue their education to the doctoral level.

please utilize 2 to 3 references so I am able to complete my research on this topic

Data security and privacy threats within a health care system.

Describe data security and privacy threats within a health care system. What are the most common causes of health information system breaches and how can these be prevented?

 Research the effects of insulin and glucagon hormones

 Research the effects of insulin and glucagon hormones on glycogenesis. Write down the reactions in gluconeogenesis in detail and analyze them in terms of liver, kidney and muscles.

Protected health information

Which data elements of the patient record are considered protected health information (PHI) and which record types across the EHR system are considered PHI? Provide reasoning and examples.

What is the importance of tillage in plant production? T

what is the importance of tillage in plant production? The most important advantage of conservation tillage systems is significantly less soil erosion…

Roles and Competencies of advanced practice nurses

Examine roles and competencies of advanced practice nurses essential to performing as leaders and advocates of holistic, safe, and quality care (CO1)  Apply concepts of person-centered care to nursing practice situations. (CO2)  Analyze essential skills needed to lead within the context of complex systems. (CO3)

  1. Explore the process of scholarship engagement to improve health and healthcare outcomes in various settings (CO4)

Due Date: 

Post should be entered to the Weekly Reflection on Learning thread by Sunday at 11:59 p.m. MST each week.

This assignment will follow the late assignment policy specified in the course syllabus.

Students are expected to submit assignments by the time they are due. Assignments submitted after the due date and time will receive a deduction of 10% of the total points possible for that assignment for each day the assignment is late. Assignments will be accepted, with penalty as described, up to a maximum of three days late, after which point a zero will be recorded for the assignment.

In the event of a situation that prevents timely submission of an assignment, students may petition their instructor for a waiver of the late submission grade reduction. The instructor will review the student’s rationale for the request and make a determination based on the merits of the student’s appeal. Consideration of the student’s total course performance to date will be a contributing factor in the determination. Students should continue to attend class, actively participate, and complete other assignments while the appeal is pending.

Total Points Possible:  5

Requirements:

Reflection: write 1-2 paragraphs reflecting on your learning for the week. Guiding questions are provided or you may write about what you felt was most significant to you for the week.
You will need to post your reflection here before you are able to see other students’ posts.

  • What were the most important concepts you learned in week 1?
  • Why were these concepts important?
  • How will they prepare you for your future role as a master’s prepared nurse?

 

Search entries or author Filter replies by unreadUnread     Collapse replies Expand replies

 

ReplyReply to Week 1: Reflection on Learning

Replies are only visible to those who have posted at least one reply.

 

PreviousNext

The nucleotide sequence

A portion of the nucleotide sequence from the DNA coding strand of the chicken ovalbumin gene is shown. ATGGGCTCCATCGGTGCAGCAAGCATGGAA… 1040 bp … TTCTTTGGC AGATGTGTTTCCCCU (a) Write the partial amino acid sequence of the encoded protein. (b) Write the 20-residue primer sequences for PCR to amplify the above DNA. (c) Write a 20-residue primer to introduce a point mutation at the third amino acid to proline.

The acetylcholine receptor

The acetylcholine receptor is an example of? Pick one answer and explain why.

A) a ligand-regulated ion channel.

B) a voltage-gated ion channel.

C) a mechanically-regulated ion channel.

D) a facilitated diffusion transporter.